2 derivative carrying the mini-Tn5 between 151-152 bp position of rosR [30] Rt2441 Rt24.2 with additional rosR upstream region introduced by pM41 integration, Kmr, Nxr This work E. coli     DH5α supE44 ΔlacU169 (φ80 lacZΔ M15) hsdR17 recA1endA1gyrA96 thi-1 relA1 [67] S17-1 294 derivative RP4-2Tc::Mu-Km::Tn7 chromosomally integrated [79] Plasmids

    pK19mobGII mob, lacZα, gusA, Kmr [80] pBBR1MCS-2 mob, lacZα, Kmr [81] pB31 pUC19 with 1174-bp BamHI fragment containing Rt24.2 rosR [23] pM41 pK19mobGII with 586-bp EcoRI-PstI fragment from pB31 containing the rosR upstream region This work pRC24 Linsitinib manufacturer pRK7813 with 1174-bp BamHI fragment containing rosR of Rt24.2 [23] pBR24 pBBR1MCS-5 with 1174-bp BamHI fragment containing rosR of Rt24.2 [23] pEX1 pBBR1MCS-2 with 586-bp EcoRI-PstI fragment containing the upstream region and the first 60 codons for RosR This work pEX8 pBBR1MCS-2 with 372-bp EcoRI-XbaI fragment containing the -403

bp to -32 bp rosR upstream region This work pEX9 pBBR1MCS-2 with 219-bp EcoRI-XbaI fragment containing the -403 bp to -185 bp rosR upstream region This work pEX60 pBBR1MCS-2 with 278-bp (-96 bp to +182 bp) EcoRI-PstI fragment containing the first 60 codons for RosR cloned downstream the vector promoter This work pBR28 pBBR1MCS-2 with 820-bp (-96 bp to +724 bp) EcoRI-BamHI fragment containing the full-length rosR cloned downstream the vector promoter This work pHC60 Vector with gfp and RK2 stabilization fragment, Tcr [39] Oligonucleotide primers Sequence (5′-3′) *   pEP1 ATGCAAGAATTCTGCACAGGAAGC

[23] pEP5 CGGTCAGGAATTCTAAGAACAGGT [23] pEP6 Dichloromethane dehalogenase TCGAAACAGGAATTCGATTCCTGC [23] pRR1 CGCATTCTAGACATGTGATCTGCT [23] pEP8 Selleckchem PD0332991 AACGGCTCTAGACTGACACGCCAAA [23] pEP9 TCATGCTCTAGACGATGGCCTCAGT [23] rosA GCGGATCCGCGACTTTACCAGATTTA [23] rosB GTCACGCTCTTCGGAATTCAGGGGT [23] rosC AGGGATCCATTCTAAACCTGTCGGCA [23] rosD TCGGATCCTGTCGGCAAAGCATAAGA [23] rosG1 GACGATCGAATTCGGCCGTCTCTT This work rosD4 TTGCGGATCCGCAGATGCCGGT This work rosD5 ACCACGCCTGGGATCCAGGAAAA This work * Sequences for EcoRI, BamHI and XbaI restriction sites are underlined. To assay the effect of clover root exudates on growth of the rosR mutants (Rt2441 and Rt2472) and the wild type, the strains were grown in 5 ml M1 medium supplemented with 5 μM exudates, which was prepared as described previously [69]. After 24, 48, 72, and 96 h, 100 μl aliquots of each culture were removed and plated in dilutions on 79CA plates, incubated 4 days at 28°C, and the colonies were counted. DNA methods: construction of Rt2441 rosR selleck chemical mutant and plasmids containing different fragments of the rosR upstream region and rosR ORF Standard techniques were used for DNA isolation, restriction enzyme digestion, cloning, and Southern hybridization [67]. For PCR amplifications, Ready Taq PCR Reaction Mix (Sigma) or PfuI polymerase (Fermentas) was used. Sequencing was performed using the BigDye terminator cycle sequencing kit (Applied Biosystems) and the ABI Prism 310 sequencer.