27, 28 Huh7 cells were transfected by Rep-Feo RNA, cultured in the presence of 500 μg/mL of G418, and a cell line that stably expressed Feo replicon was established. For HCV cell culture, the HCV-JFH1 strain was used.29,

30 Antibodies used were anti–IRF-3 (FL-425, Santa Cruz Biotechnology), anti-HA (Invitrogen), anti-myc (Invitrogen), mouse anti-PDI PD0325901 (Abcam), rabbit anti-PDI (Enzo Life Science), anti-Flag (Sigma Aldrich), anti-Cardif (Enzo Life Science), anti-phospho–IRF-3 (Ser396, Millipore), anti-monomeric Kusabira-Green C- or N-terminal fragment (MBL), and anti-FACL4 (Abgent). IFN-β reporter assays were performed as described.19, 31 The plasmids pIFN-β-Fluc and pRL-CMV were cotransfected with NS3/4A or NS4B, and ΔRIG-I, Cardif, STING or poly(deoxyadenylic-deoxythymidylic) acid [poly(dA:dT)] (Invivogen). RIG-IKA, ΔCARD, and pcDNA3.1, respectively, were used as controls. Luciferase assays were performed 24 hours after transfection by using a 1420 Multilabel Counter (ARVO MX PerkinElmer) and Dual Luciferase Assay System (Promega). Assays were performed in triplicate, and the results are expressed as the mean ± SD. Preparation

of total cell lysates was performed as described.19, 28 Protein was separated using NuPAGE 4%-12% Bis/Tris gels (Invitrogen) and blotted onto an Immobilon polyvinylidene difluoride membrane. The membrane was Roxadustat cost immunoblotted with primary followed by secondary antibody, and protein was detected by chemiluminescence. HEK-293T or Huh7 cells were transfected with plasmids as indicated. Twenty-four

selleckchem hours after transfection, cellular proteins were harvested and immunoprecipitation assays were performed using an Immunoprecipitation Kit according to the manufacturer’s protocol (Roche Applied Science). The immunoprecipitated proteins were analyzed by immunoblotting. Cells seeded onto tissue culture chamber slides were transfected with plasmids as indicated. Twenty-four hours after transfection, the cells were fixed with cold acetone and incubated with primary antibody and subsequently with Alexa488- or Alexa568-labeled secondary antibodies. Mitochondria were stained by MitoTracker (Invitrogen). Cells were visualized using a confocal laser microscope (Fluoview FV10, Olympus). Expression plasmids of NS4B, Cardif, or STING that was fused with N- or C-terminally truncated monomeric Kusabira-Green (mKG) were constructed by inserting polymerase chain reaction–amplified fragments encoding NS4B, Cardif, or STING, respectively, inserted into fragmented mKG vector (Coral Hue Fluo-Chase Kit; MBL). HEK293T cells were transfected with a complementary pair of mKG fusion plasmids. Twenty-four hours after transfection, fluorescence-positive cells were detected and counted by flow cytometry, or observed by confocal laser microscopy. Nucleotide sequences of STING-targeted small interfering RNAs (siRNAs) were as follows: (1) 5′-gcaacagcatctatgagcttctggagaac-3′, (2) 5′- gtgcagtgagccagcggctgtatattctc;-3′, (3) 5′-gctggcatggtcatattacatcggatatc-3′.